Galnt12^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Galnt12^em1(IMPC)J
• Name: polypeptide N-acetylgalactosaminyltransferase 12; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5662540
• Synonyms: Galnt12^em1J
• Gene: Galnt12 Location: Chr4:47091909-47123070 bp, + strand Genetic Position: Chr4, 25.96 cM
• Alliance: Galnt12^em1(IMPC)J page
• IMPC: Galnt12 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Galnt12- 6964J-M4370 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences: GCTTGCTCTGCCAAAGACGT, TGCTTGCTCTGCCAAAGACG, AAGCAAGGACAGATTCACCT, GGAACTCTGTGATGGTACAA, which resulted in a 347 bp deletion beginning in intron 3 at Chromosome 4 positive strand position 47,108,346 bp, GCCAAAGACGTGGGACAATGACC, and ending after ACTCTGTGATGGTACAATG at position 47,108,692 bp (GRCm38/mm10) in intron 4. This mutation deletes exon 3 and is predicted to cause an amino acid change after 175 amino acids and early truncation 15 residues later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Galnt12 Mutation: 35 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)