About   Help   FAQ
Galnt12em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Galnt12em1(IMPC)J
Name: polypeptide N-acetylgalactosaminyltransferase 12; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5662540
Synonyms: Galnt12em1J
Gene: Galnt12  Location: Chr4:47091909-47123070 bp, + strand  Genetic Position: Chr4, 25.96 cM
Alliance: Galnt12em1(IMPC)J page
IMPC: Galnt12 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Galnt12- 6964J-M4370 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences: GCTTGCTCTGCCAAAGACGT, TGCTTGCTCTGCCAAAGACG, AAGCAAGGACAGATTCACCT, GGAACTCTGTGATGGTACAA, which resulted in a 347 bp deletion beginning in intron 3 at Chromosome 4 positive strand position 47,108,346 bp, GCCAAAGACGTGGGACAATGACC, and ending after ACTCTGTGATGGTACAATG at position 47,108,692 bp (GRCm38/mm10) in intron 4. This mutation deletes exon 3 and is predicted to cause an amino acid change after 175 amino acids and early truncation 15 residues later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Galnt12 Mutation:  35 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory