About   Help   FAQ
Mon1aem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Mon1aem1(IMPC)J
Name: MON1 homolog A, secretory traffciking associated; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5662453
Synonyms: Mon1aem1J
Gene: Mon1a  Location: Chr9:107765350-107780338 bp, + strand  Genetic Position: Chr9, 59.07 cM, cytoband F2
Alliance: Mon1aem1(IMPC)J page
IMPC: Mon1a gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Mon1a-6967J-F4413 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences: GAGGTAAAAGAAGGACACCA, CTAAGTCAACGACCTGGGGA, CTAGTGACTGAGCAACATGT, GTAGAATAGCCAGGCCTCCA, which resulted in a 355bp deletion beginning in intron 2 at Chromosome 9 positive strand position 107,898,539 bp, GAAGCCATCCCCAGGTCGTTGACTTA, and ending after CTTCCTTTCCTTCCTACATG at 107,898,893 bp (GRCm38/mm10) in intron 3, which results in the deletion of exon 2, which is the first coding exon, so lacks the translation start site and first 42 amino acids and is predicted to be a null allele. If splicing and translation occurs from the first ATG in exon 3, this would produce a 507 amino acid protein that differs from wildtype by the lack of the first 49 amino acids. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Mon1a Mutation:  17 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/24/2026
MGI 6.24
The Jackson Laboratory