Mon1a^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Mon1a^em1(IMPC)J
• Name: MON1 homolog A, secretory traffciking associated; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5662453
• Synonyms: Mon1a^em1J
• Gene: Mon1a Location: Chr9:107765350-107780338 bp, + strand Genetic Position: Chr9, 59.07 cM, cytoband F2
• Alliance: Mon1a^em1(IMPC)J page
• IMPC: Mon1a gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory using Cas9 and guides with spacer sequences CTAAGTCAACGACCTGGGGA, CTAGTGACTGAGCAACATGT, GAGGTAAAAGAAGGACACCA, and TGGAGGCCTGGCTATTCTAC that targeted exon(s) ENSMUSE00000221174.2. This resulted in deletion(s) of 355 bp (location: Chr9:107775738-107776092; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Mon1a Mutation: 17 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 4 reference(s)