About   Help   FAQ
Pbsnem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Pbsnem1(IMPC)J
Name: probasin; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5662440
Synonyms: Pbsnem1J
Gene: Pbsn  Location: ChrX:76881504-76897132 bp, - strand  Genetic Position: ChrX, 38.32 cM, cytoband A7.1
Alliance: Pbsnem1(IMPC)J page
IMPC: Pbsn gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Pbsn-6978J-F3145 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences: TTAAGGTCGTGCATTCATTC,ACATTGGAATGTAGATATCA,TCGTATTGTATATTACTCCA, and TTTATGTGGAATCAGGACCC, which resulted in a 212 bp deletion in intron 3 beginning at Chromosome X negative strand position 77,845,123 bp, CCCTGGAGTAATATACAATACG, and ending after TGATATCTACATTCCAATGTAA at 77,844,912 bp (GRCm38/mm10) in intron 4. This mutation deletes exon 3 and is predicted to cause early truncation after 72 amino acids. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Pbsn Mutation:  21 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
08/05/2025
MGI 6.24
The Jackson Laboratory