About   Help   FAQ
Krt80em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Krt80em1(IMPC)J
Name: keratin 80; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5662436
Synonyms: Krt80em1J
Gene: Krt80  Location: Chr15:101246196-101268043 bp, - strand  Genetic Position: Chr15, 56.78 cM, cytoband F3
Alliance: Krt80em1(IMPC)J page
IMPC: Krt80 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Krt80-6977J-M3128 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences: ACTTCCTCTTTCTCCACCTT,CACCCCACCAGAGTACAGCC, TGACAGGGAGCCCCACCTCG, and AGATGAGCTGCCCTGTGACA, which resulted in a 378 bp deletion beginning in intron 2 at Chromosome 15 negative strand position 101,364,511 bp, GTGACAGGGAGCCCCACCTCG, and ending after CTGGTGGGGTGCACCCAAG at 101,364,134 bp (GRCm38/mm10) in intron 3. This mutation deletes exon 2 and is predicted to cause an early stop after amino acid residue 101. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 3 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Krt80 Mutation:  17 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory