Pla2g7em1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Pla2g7em1(IMPC)J |
| Name: |
phospholipase A2, group VII (platelet-activating factor acetylhydrolase, plasma); endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:5662431 |
| Synonyms: |
Pla2g7em1J |
| Gene: |
Pla2g7 Location: Chr17:43879009-43923093 bp, + strand Genetic Position: Chr17, 19.74 cM, cytoband C
|
| Alliance: |
Pla2g7em1(IMPC)J page
|
| IMPC: |
Pla2g7 gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele from project Pla2g7-7002J-F3490 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences: TAGCCAGTCCGCCTAAAAGT, AGTAGGTGCTAGGAATTCCA, GTCATTCTCAGGAGACTGCA, and GCTGTTGCAACAGGGATGGC, which resulted in a 301 bp deletion beginning in intron 3 at Chromosome 17 positive strand position 43,594,225 bp, CTACTTTTAGGCGGACTGGCTA, and ending after CTAACCGGCCATCCCTGTTG at 43,594,525 bp (GRCm38/mm10) in intron 4. This mutation deletes exon 3 and is predicted to cause amino acid sequence changes after residue 35 and early truncation 30 amino acids later. There is an additional 16 bp deletion 12 bases before the beginning of the 301 bp deletion. This additional deletion is in intron 3 and is not expected to impact the exon deletion results.
(J:188991)
|
| Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
3 reference(s) |
|