Vopp1em1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Vopp1em1(IMPC)J |
| Name: |
vesicular, overexpressed in cancer, prosurvival protein 1; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:5659670 |
| Synonyms: |
Vopp1em1J |
| Gene: |
Vopp1 Location: Chr6:57729249-57802110 bp, - strand Genetic Position: Chr6, 27.82 cM
|
| Alliance: |
Vopp1em1(IMPC)J page
|
| IMPC: |
Vopp1 gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele from project Vopp1-6899J-M261 was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guides sequences, CCTATAAAAGAAACCGCTCC, CTGAGGCCAAAAAACATTGC and TACACTACTGAAAAGGTCTC, which resulted in a 93 bp deletion beginning in exon 2 at Chromosome 6 negative strand position 57,790,014 bp, at TGCTGGTATTTTGAAGGACT, and ending after TCAGTTTTTTTTCTCCAGGA at position 57,789,922 bp in intron 3 (GRCm38). This mutation deletes 38 bp in exon 2 as well as the splice donor to essentially delete the exon. This mutation is predicted to cause amino acid sequence changes after residue 25 and with read through into the intron, early truncation 24 amino acids later.
(J:188991)
|
| Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
3 reference(s) |
|