About   Help   FAQ
Vopp1em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Vopp1em1(IMPC)J
Name: vesicular, overexpressed in cancer, prosurvival protein 1; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5659670
Synonyms: Vopp1em1J
Gene: Vopp1  Location: Chr6:57729249-57802110 bp, - strand  Genetic Position: Chr6, 27.82 cM
Alliance: Vopp1em1(IMPC)J page
IMPC: Vopp1 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Vopp1-6899J-M261 was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guides sequences, CCTATAAAAGAAACCGCTCC, CTGAGGCCAAAAAACATTGC and TACACTACTGAAAAGGTCTC, which resulted in a 93 bp deletion beginning in exon 2 at Chromosome 6 negative strand position 57,790,014 bp, at TGCTGGTATTTTGAAGGACT, and ending after TCAGTTTTTTTTCTCCAGGA at position 57,789,922 bp in intron 3 (GRCm38). This mutation deletes 38 bp in exon 2 as well as the splice donor to essentially delete the exon. This mutation is predicted to cause amino acid sequence changes after residue 25 and with read through into the intron, early truncation 24 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Vopp1 Mutation:  18 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/30/2025
MGI 6.24
The Jackson Laboratory