About   Help   FAQ
Abca9em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Abca9em1(IMPC)J
Name: ATP-binding cassette, sub-family A member 9; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5649019
Synonyms: Abca9em1J
Gene: Abca9  Location: Chr11:109991575-110059022 bp, - strand  Genetic Position: Chr11, 73.22 cM
Alliance: Abca9em1(IMPC)J page
IMPC: Abca9 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Abca9-6893J-M2445 was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guides sequences, ACAATCTCATCAGTCAACTC, CATTATCTCATGGGTGGCTT and CTTTTAAGTACTTGACTCTA, which resulted in a 467 bp deletion beginning in intron 3 at Chromosome 11 negative strand position 110,163,505 bp, at TTAAAAGTGGAGAAACTTAAATGG, and ending after CTGATGAGATTGTTGGAC at position 110,163,039 bp in intron 4 (GRCm38). This mutation deletes exon 3 and is predicted to cause amino acid sequence changes after residue 33 and early truncation 11 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Abca9 Mutation:  96 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/30/2025
MGI 6.24
The Jackson Laboratory