Nt5dc1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Nt5dc1^em1(IMPC)J
• Name: 5'-nucleotidase domain containing 1; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5649018
• Synonyms: Nt5dc1^em1J
• Gene: Nt5dc1 Location: Chr10:34179605-34294585 bp, - strand Genetic Position: Chr10, 18.85 cM
• Alliance: Nt5dc1^em1(IMPC)J page
• IMPC: Nt5dc1 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Nt5dc1-6897-M2486 was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guides sequences, CAGGGGATGCAGGTGAACAA, TTCTCCTTGACTAAGAACTG and AGCAGAATCACTAATGGGGT which resulted in a 204 bp deletion beginning in intron 2 at Chromosome 10 negative strand position 34,411,544 bp, at ATTCTGCTAGGATTTTAGGTC, and ending after TCCAACCCCTTGTTCACCTG at position 34,411,341 bp in intron 3 (GRCm38). This mutation deletes 85bp from intron 2, deletes exon2 (92bp) and 27bp in intron 3. The deletion of exon 2 predicts a change in amino acid sequence after amino acid residue 32 and early truncation 13 residues later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Nt5dc1 Mutation: 25 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)