About   Help   FAQ
Nt5dc1em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Nt5dc1em1(IMPC)J
Name: 5'-nucleotidase domain containing 1; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5649018
Synonyms: Nt5dc1em1J
Gene: Nt5dc1  Location: Chr10:34179605-34294585 bp, - strand  Genetic Position: Chr10, 18.85 cM
Alliance: Nt5dc1em1(IMPC)J page
IMPC: Nt5dc1 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Nt5dc1-6897-M2486 was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guides sequences, CAGGGGATGCAGGTGAACAA, TTCTCCTTGACTAAGAACTG and AGCAGAATCACTAATGGGGT which resulted in a 204 bp deletion beginning in intron 2 at Chromosome 10 negative strand position 34,411,544 bp, at ATTCTGCTAGGATTTTAGGTC, and ending after TCCAACCCCTTGTTCACCTG at position 34,411,341 bp in intron 3 (GRCm38). This mutation deletes 85bp from intron 2, deletes exon2 (92bp) and 27bp in intron 3. The deletion of exon 2 predicts a change in amino acid sequence after amino acid residue 32 and early truncation 13 residues later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 2 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Nt5dc1 Mutation:  25 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
04/23/2024
MGI 6.23
The Jackson Laboratory