About   Help   FAQ
Ccdc78em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Ccdc78em1(IMPC)J
Name: coiled-coil domain containing 78; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5649017
Synonyms: Ccdc78em1J
Gene: Ccdc78  Location: Chr17:26005554-26009487 bp, + strand  Genetic Position: Chr17, 12.89 cM
Alliance: Ccdc78em1(IMPC)J page
IMPC: Ccdc78 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Ccdc78-6895J-M2468 was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guides sequences, GATCCTTCTTTAGGGGATGA, CAGGACAACTGGTCAGCAAC and CTTGGGTACTCCCAGGTGCT, which resulted in a 205 bp deletion beginning in intron 6 at Chromosome 17 positive strand position 25,787,901 bp, beginning at GGATGACGGATGACCTCACCC, and ending after AAACAGAGCAATCGCCTCTTG at position 25,788,105 bp in intron 7 (GRCm38). This mutation deletes exon 6 and is predicted to cause amino acid sequence changes after residue 167 and early truncation 22 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Ccdc78 Mutation:  15 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/30/2025
MGI 6.24
The Jackson Laboratory