Wdr17^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Wdr17^em1(IMPC)J
• Name: WD repeat domain 17; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5649014
• Synonyms: Wdr17^em1J
• Gene: Wdr17 Location: Chr8:55082316-55180014 bp, - strand Genetic Position: Chr8, 29.28 cM, cytoband B3.1
• Alliance: Wdr17^em1(IMPC)J page
• IMPC: Wdr17 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Wdr17-6900-M282 was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guides sequences, TTAGTTAATCACACCTTCGA, CGTTCCAAATGATCACTAAG and AACAGTTGAGTTCTTCTTTT, which resulted in a 159 bp deletion beginning in intron 4 at Chromosome 8 negative strand position 54,693,261 bp starting at GTTGGGCATGCTTTGTTTTAG and ending after TAACTTAGTGATCATTTGG at position 54,693,103 bp in exon 4 (GRCm38). This mutation removes 21 bp from intron 4 and 138bp from exon 4 essentially deleting exon 4 from the transcript, and is predicted to cause an amino acid change after residue 65 and early truncation 141 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Wdr17 Mutation: 83 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)