About   Help   FAQ
Spink12em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Spink12em1(IMPC)J
Name: serine peptidase inhibitor, Kazal type 12; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5649013
Synonyms: Spink12em1J
Gene: Spink12  Location: Chr18:44237474-44241610 bp, + strand  Genetic Position: Chr18, 23.74 cM, cytoband B3
Alliance: Spink12em1(IMPC)J page
IMPC: Spink12 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Spink12-6847-M9341 was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guides sequences, CATTGTGGTTAGCTGCAACT, AGGAGGCTTTCAGGTATGTA and CCCCAGTGCTTAAGTTGGAA, which resulted in a 109 bp deletion beginning in intron 2 at Chromosome 18 negative strand position 44,106,529 bp starting at CCTTGGCTCACAGCATCTACAGTGA and ending after ATGGGGTTCTGCTGCGTCTGT at position 44,106,421 bp in exon 3 (GRCm38). This mutation results in a 93bp deletion in intron 2 and 16bp deletion in exon 2 removing the splice donor, which is predicted to prevent splicing to exon 2 and to result in amino acid changes after residue 38 and early truncation 6 residues later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 2 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Spink12 Mutation:  11 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  4 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/30/2025
MGI 6.24
The Jackson Laboratory