About   Help   FAQ
Rab11fip4em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Rab11fip4em1(IMPC)J
Name: RAB11 family interacting protein 4 (class II); endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5644714
Synonyms: Rab11fip4em1J
Gene: Rab11fip4  Location: Chr11:79482038-79588849 bp, + strand  Genetic Position: Chr11, 46.88 cM
Alliance: Rab11fip4em1(IMPC)J page
IMPC: Rab11fip4 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Rab11fip4-6842J-M9341 was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guides sequences, CGTCTACAAGTGCGTCTGCA, ATGACATTGGCCCTACCTGA and ACGGGTACTTTCTAGCTCCG, which resulted in a 405bp deletion beginning in intron 4 at CGTGACTCAGCCACCATGAGAG at Chromosome 11 positive strand position 79,680,652 bp (GRCm38) and ending after TTTCTAGCTCCGGGGCCACATGCC at position 79,681,056 bp in intron 5. This mutation deletes exon 4 and is predicted to cause amino acid sequence changes after residue 112 and early truncation 28 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Rab11fip4 Mutation:  48 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/30/2025
MGI 6.24
The Jackson Laboratory