About   Help   FAQ
Olfml2bem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Olfml2bem1(IMPC)J
Name: olfactomedin-like 2B; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5644713
Synonyms: Olfml2bem1J
Gene: Olfml2b  Location: Chr1:170472101-170510356 bp, + strand  Genetic Position: Chr1, 76.95 cM
Alliance: Olfml2bem1(IMPC)J page
IMPC: Olfml2b gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Olfml2b-6834J-F3656 was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guides sequences, ATACAGTCGCACTTCCCAAG, AATCACCTACTATAAAGCCA and GGGATTTCATCCTTAGTGCA which resulted in a 390bp deletion beginning in intron 5 at GGCCCTCTTGGGAAGTGCGACTGTAT at Chromosome 1 positive strand position 170,666,451 bp (GRCm38) and ending after TCAGGGATTTCATCCTTAGTGCAG at position 170,666,840 bp in intron 6. This mutation deletes exon 5 and is predicted to cause amino acid sequence changes after residue 241 and early truncation 13 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Olfml2b Mutation:  40 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory