Olfml2bem1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Olfml2bem1(IMPC)J |
| Name: |
olfactomedin-like 2B; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:5644713 |
| Synonyms: |
Olfml2bem1J |
| Gene: |
Olfml2b Location: Chr1:170472101-170510356 bp, + strand Genetic Position: Chr1, 76.95 cM
|
| Alliance: |
Olfml2bem1(IMPC)J page
|
| IMPC: |
Olfml2b gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele from project Olfml2b-6834J-F3656 was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guides sequences, ATACAGTCGCACTTCCCAAG, AATCACCTACTATAAAGCCA and GGGATTTCATCCTTAGTGCA which resulted in a 390bp deletion beginning in intron 5 at GGCCCTCTTGGGAAGTGCGACTGTAT at Chromosome 1 positive strand position 170,666,451 bp (GRCm38) and ending after TCAGGGATTTCATCCTTAGTGCAG at position 170,666,840 bp in intron 6. This mutation deletes exon 5 and is predicted to cause amino acid sequence changes after residue 241 and early truncation 13 amino acids later.
(J:188991)
|
| Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
3 reference(s) |
|