About   Help   FAQ
Kcnd3em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Kcnd3em1(IMPC)J
Name: potassium voltage-gated channel, Shal-related family, member 3; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5644712
Synonyms: Kcnd3em1J
Gene: Kcnd3  Location: Chr3:105359646-105581318 bp, + strand  Genetic Position: Chr3, 46.32 cM, cytoband F3
Alliance: Kcnd3em1(IMPC)J page
IMPC: Kcnd3 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Kcnd3- 6780J-M7405 was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guides sequences, TGTTCGAGCAAGTGAGTGAT, TGGTGCCTAAGACAATCGCA and GCATGGACGTCCTCTCACT which resulted in a 327bp deletion beginning in intron 3 at GTTTCCCACATGGCCTCTTA at Chromosome 3 positive strand position 105,658,545 bp (GRCm38) and ending after TAAGTAAGAGGCCATGTGGGAAAC at position 105,658,871 bp in intron 4. This mutation deletes exon 3 and is predicted to cause amino acid sequence changes after residue 369 and early truncation 32 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Kcnd3 Mutation:  62 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  5 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
10/07/2025
MGI 6.24
The Jackson Laboratory