About   Help   FAQ
Klra7em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Klra7em1(IMPC)J
Name: killer cell lectin-like receptor, subfamily A, member 7; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5644523
Synonyms: Klra7em1J
Gene: Klra7  Location: Chr6:130195568-130210285 bp, - strand  Genetic Position: Chr6, 63.44 cM
Alliance: Klra7em1(IMPC)J page
IMPC: Klra7 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Klra7-6781J-M7991 was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guide sequences: TCTTGTACTTGTGCATAACC, CAGTCCTCACTAGTTTCTGC and GACATGGACTGACCAAATT which resulted in a 241 bp deletion beginning in 5 upstream sequence at Chromosome 6 negative strand position 130,231,784 bp, beginning TCAGGGTGTTTATAGCATTAAG, and ending after GTTGCAGAAACTAGTGAGGAC in exon 1 at 130,231,544 bp (GRCm38/mm10). This mutation deletes the 5-prime UTR region and part of exon 1 and is predicted to not produce a protein product. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Klra7 Mutation:  19 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/06/2026
MGI 6.24
The Jackson Laboratory