Rnf10^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rnf10^em1(IMPC)J
• Name: ring finger protein 10; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5644522
• Synonyms: Rnf10^em1J
• Gene: Rnf10 Location: Chr5:115379829-115410951 bp, - strand Genetic Position: Chr5, 56.01 cM
• Alliance: Rnf10^em1(IMPC)J page
• IMPC: Rnf10 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Rnf10-6732J-M6624 was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guide sequences: GTGAATTGGAGCGACGGGAC, AGACACGGCCAATTTCTATC and GCACGCACTCACACTTTGAC, (along with a plasmid containing 1 kb homology arms flanking the floxed critical exon, which did not integrate) which resulted in a 302 bp deletion beginning in intron 2 at Chromosome 5 negative strand position 115,260,367 bp at GCCGTGTCTGGGAAAACATTAAA and ending after CCTGTCAAAGTGTGAGTGCGTG in intron 3 at 115,260,066 bp (GRCm38/mm10). This mutation deletes all of exon 2 and is predicted to cause amino acid sequence changes after 52 residues and early truncation 9 amino acid residues later. PCR failed to detect the insertion of any loxP sites. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Rnf10 Mutation: 55 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)