About   Help   FAQ
Rnf10em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Rnf10em1(IMPC)J
Name: ring finger protein 10; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5644522
Synonyms: Rnf10em1J
Gene: Rnf10  Location: Chr5:115379829-115410951 bp, - strand  Genetic Position: Chr5, 56.01 cM
Alliance: Rnf10em1(IMPC)J page
IMPC: Rnf10 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Rnf10-6732J-M6624 was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guide sequences: GTGAATTGGAGCGACGGGAC, AGACACGGCCAATTTCTATC and GCACGCACTCACACTTTGAC, (along with a plasmid containing 1 kb homology arms flanking the floxed critical exon, which did not integrate) which resulted in a 302 bp deletion beginning in intron 2 at Chromosome 5 negative strand position 115,260,367 bp at GCCGTGTCTGGGAAAACATTAAA and ending after CCTGTCAAAGTGTGAGTGCGTG in intron 3 at 115,260,066 bp (GRCm38/mm10). This mutation deletes all of exon 2 and is predicted to cause amino acid sequence changes after 52 residues and early truncation 9 amino acid residues later. PCR failed to detect the insertion of any loxP sites. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Rnf10 Mutation:  55 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory