Oard1em1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Oard1em1(IMPC)J |
Name: |
O-acyl-ADP-ribose deacylase 1; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:5644469 |
Synonyms: |
Oard1em1J |
Gene: |
Oard1 Location: Chr17:48717042-48724294 bp, + strand Genetic Position: Chr17, 23.99 cM
|
Alliance: |
Oard1em1(IMPC)J page
|
IMPC: |
Oard1 gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele from project Oard1-6555J-F6345 was generated at The Jackson Laboratory by injecting Cas9 RNA and 2 guide sequences, CCAAAACAGACTCTCTAGCCCAT and ATCAGTGAGGATTGTCGAAT, which resulted in a 287 bp deletion beginning in intron 3 at Chromosome 17 positive strand position 48,411,029 bp, CTGATTTACTTAGAAAAGGC, and ending after GTCCCAAAACAGACTCTCTAG in exon 3 at 48,411,315 bp (GRCm38/mm10). This mutation deletes part of exon 3 and the splice acceptor and is predicted to cause the complete loss of exon 3 resulting in amino acid sequence changes after 13 residues and early truncation 9 amino acid residues later.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
3 reference(s) |
|