About   Help   FAQ
Dock6em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Dock6em1(IMPC)J
Name: dedicator of cytokinesis 6; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5639331
Synonyms: Dock6em1J
Gene: Dock6  Location: Chr9:21711476-21764006 bp, - strand  Genetic Position: Chr9, 7.89 cM, cytoband A4
Alliance: Dock6em1(IMPC)J page
IMPC: Dock6 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Dock6-6207J-FP2B was generated at The Jackson Laboratory by injecting Cas9 RNA and guide sequence TGGTGACAGTTAACGTGGCC, which resulted in a 145 bp deletion and a T insertion in exon12 beginning at Chromosome 9 negative strand position 21,839,387 bp, CGGCCACGTTAACTGTCACCA, and ending after TACCTTGGGGAATCTGTATC at 21,839,244 bp (GRCm38/mm10). This mutation deletes the last 34 bp of coding sequence in exon 12, 111 bp in intron 13 as well as the splice donor and is predicted to result in a read through into exon 13 causing amino acid sequence changes after residue 448 and early truncation 26 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Dock6 Mutation:  151 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/06/2026
MGI 6.24
The Jackson Laboratory