Dock6em1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Dock6em1(IMPC)J |
| Name: |
dedicator of cytokinesis 6; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:5639331 |
| Synonyms: |
Dock6em1J |
| Gene: |
Dock6 Location: Chr9:21711476-21764006 bp, - strand Genetic Position: Chr9, 7.89 cM, cytoband A4
|
| Alliance: |
Dock6em1(IMPC)J page
|
| IMPC: |
Dock6 gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele from project Dock6-6207J-FP2B was generated at The Jackson Laboratory by injecting Cas9 RNA and guide sequence TGGTGACAGTTAACGTGGCC, which resulted in a 145 bp deletion and a T insertion in exon12 beginning at Chromosome 9 negative strand position 21,839,387 bp, CGGCCACGTTAACTGTCACCA, and ending after TACCTTGGGGAATCTGTATC at 21,839,244 bp (GRCm38/mm10). This mutation deletes the last 34 bp of coding sequence in exon 12, 111 bp in intron 13 as well as the splice donor and is predicted to result in a read through into exon 13 causing amino acid sequence changes after residue 448 and early truncation 26 amino acids later.
(J:188991)
|
| Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
3 reference(s) |
|