About   Help   FAQ
Trip13em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Trip13em1(IMPC)J
Name: thyroid hormone receptor interactor 13; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5639079
Synonyms: Trip13em1J
Gene: Trip13  Location: Chr13:74060577-74085855 bp, - strand  Genetic Position: Chr13, 40.15 cM, cytoband C1
Alliance: Trip13em1(IMPC)J page
IMPC: Trip13 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Trip13-6637J-2781F was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guide sequences, CACTAAAGTATAGCTAGGTC, TTGTGTTTGGAGATTACGTC and CGGGTTACTACCCTATCTGT which resulted in a 556bp deletion beginning in intron 1 at CTAGCTATACTTTAGTGGG at Chromosome 13 negative strand position 73,936,559 bp (GRCm38) and ending after TAGCGGGTTACTACCCTATC at position 73,936,004 bp in intron 2. This mutation deletes exon 2 and is predicted to cause amino acid sequence changes after residue 31 and early truncation 3 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 2 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Trip13 Mutation:  32 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/30/2025
MGI 6.24
The Jackson Laboratory