About   Help   FAQ
Ap4e1em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Ap4e1em1(IMPC)J
Name: adaptor-related protein complex AP-4, epsilon 1; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5638898
Synonyms: Ap4e1em1J
Gene: Ap4e1  Location: Chr2:126850637-126909829 bp, + strand  Genetic Position: Chr2, 61.76 cM
Alliance: Ap4e1em1(IMPC)J page
IMPC: Ap4e1 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Ap4e1-6638-2877F was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guide sequences, GCAATCAAGTTGGCCCAACA, TGTCCTGACTGTCGTTTTTA and CTGTTTGTTTACATAGTGAT which resulted in a 1bp insertion A in exon 3 beginning at Chromosome 2 positive strand position 127,014,235 bp (GRCm38). This mutation is predicted to cause amino acid sequence changes after residue 105 and early truncation 19 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Ap4e1 Mutation:  57 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory