About   Help   FAQ
Dnase1l2em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Dnase1l2em1(IMPC)J
Name: deoxyribonuclease 1-like 2; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5638888
Synonyms: Dnase1l2em1J
Gene: Dnase1l2  Location: Chr17:24659061-24662075 bp, - strand  Genetic Position: Chr17, 12.39 cM, cytoband A3.3
Alliance: Dnase1l2em1(IMPC)J page
IMPC: Dnase1l2 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Dnase1l2-6639J-M2859 was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guide sequences, ex3.g1-GGCCGGCTATGATATCGCCC, int2.g1- GGCAATTAGGCTGATTGGGA, and int3.g1- TTGGTTCGGTGCCTTGACCC, which resulted in a 198bp deletion beginning in intron 2 at CTGATTGGGACGGTGCATCTGTGGG Chromosome 17 negative strand position 24,442,529 bp (GRCm38) and ending after GGTGCCTTGACCCAGGGACTGG at position 24,442,332 bp in intron 3. This mutation deletes exon 3 and is predicted to cause amino acid sequence changes after residue 48 and early truncation 16 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 2 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Dnase1l2 Mutation:  25 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/05/2024
MGI 6.24
The Jackson Laboratory