Dnase1l2em1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Dnase1l2em1(IMPC)J |
| Name: |
deoxyribonuclease 1-like 2; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:5638888 |
| Synonyms: |
Dnase1l2em1J |
| Gene: |
Dnase1l2 Location: Chr17:24659054-24662075 bp, - strand Genetic Position: Chr17, 12.39 cM, cytoband A3.3
|
| Alliance: |
Dnase1l2em1(IMPC)J page
|
| IMPC: |
Dnase1l2 gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele from project Dnase1l2-6639J-M2859 was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guide sequences, ex3.g1-GGCCGGCTATGATATCGCCC, int2.g1- GGCAATTAGGCTGATTGGGA, and int3.g1- TTGGTTCGGTGCCTTGACCC, which resulted in a 198bp deletion beginning in intron 2 at CTGATTGGGACGGTGCATCTGTGGG Chromosome 17 negative strand position 24,442,529 bp (GRCm38) and ending after GGTGCCTTGACCCAGGGACTGG at position 24,442,332 bp in intron 3. This mutation deletes exon 3 and is predicted to cause amino acid sequence changes after residue 48 and early truncation 16 amino acids later.
(J:188991)
|
| Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
3 reference(s) |
|