Myom1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Myom1^em1(IMPC)J
• Name: myomesin 1; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5629301
• Synonyms: Myom1^em1J
• Gene: Myom1 Location: Chr17:71326455-71433851 bp, + strand Genetic Position: Chr17, 41.87 cM
• Alliance: Myom1^em1(IMPC)J page
• IMPC: Myom1 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Myom1-6238J-102P4ML was generated at The Jackson Laboratory by injecting Cas9 RNA and guide sequence TCGTGCGAAGGTCCTTGTTC, which resulted in a 37 bp deletion CCATCAGCACTATGATCTCAGTTACCGGAACAAGGAC in exon2 beginning at chromosome 17 positive strand position 71022901-71022937 bp (GRCm38) that is predicted to cause amino acid sequence changes after residue 9 and early truncation 4 amino acid residues later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Myom1 Mutation: 72 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)