About   Help   FAQ
Myom1em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Myom1em1(IMPC)J
Name: myomesin 1; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5629301
Synonyms: Myom1em1J
Gene: Myom1  Location: Chr17:71326455-71433851 bp, + strand  Genetic Position: Chr17, 41.87 cM
Alliance: Myom1em1(IMPC)J page
IMPC: Myom1 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Myom1-6238J-102P4ML was generated at The Jackson Laboratory by injecting Cas9 RNA and guide sequence TCGTGCGAAGGTCCTTGTTC, which resulted in a 37 bp deletion CCATCAGCACTATGATCTCAGTTACCGGAACAAGGAC in exon2 beginning at chromosome 17 positive strand position 71022901-71022937 bp (GRCm38) that is predicted to cause amino acid sequence changes after residue 9 and early truncation 4 amino acid residues later. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Myom1 Mutation:  72 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
04/23/2024
MGI 6.23
The Jackson Laboratory