About   Help   FAQ
Serpina7em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Serpina7em1(IMPC)J
Name: serine (or cysteine) peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 7; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5620681
Synonyms: Serpina7em1J
Gene: Serpina7  Location: ChrX:137980006-137985985 bp, - strand  Genetic Position: ChrX, 61.23 cM, cytoband F1
Alliance: Serpina7em1(IMPC)J page
IMPC: Serpina7 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Serpina7-6133J-FP4L was generated at The Jackson Laboratory by injecting Cas9 RNA and guide sequences GTCATTTGCCCCAACAAAAT and ATACAGACTGAATGCAAAGT which resulted in a 7 bp deletion ATTTGCC in exon2 beginning at Chromosome X negative strand position 139,083,601 - 139,083,595 bp (GRCm38). This mutation is predicted to cause amino acid sequence changes after residue 41 and early truncation 31 amino acids later. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Serpina7 Mutation:  5 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/06/2026
MGI 6.24
The Jackson Laboratory