Serpina7^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Serpina7^em1(IMPC)J
• Name: serine (or cysteine) peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 7; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5620681
• Synonyms: Serpina7^em1J
• Gene: Serpina7 Location: ChrX:137980006-137985985 bp, - strand Genetic Position: ChrX, 61.23 cM, cytoband F1
• Alliance: Serpina7^em1(IMPC)J page
• IMPC: Serpina7 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Serpina7-6133J-FP4L was generated at The Jackson Laboratory by injecting Cas9 RNA and guide sequences GTCATTTGCCCCAACAAAAT and ATACAGACTGAATGCAAAGT which resulted in a 7 bp deletion ATTTGCC in exon2 beginning at Chromosome X negative strand position 139,083,601 - 139,083,595 bp (GRCm38). This mutation is predicted to cause amino acid sequence changes after residue 41 and early truncation 31 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Serpina7 Mutation: 5 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)