Ddx59em1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Ddx59em1(IMPC)J |
| Name: |
DEAD box helicase 59; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:5620213 |
| Synonyms: |
Ddx59-, Ddx59em1J |
| Gene: |
Ddx59 Location: Chr1:136343009-136367896 bp, + strand Genetic Position: Chr1, 59.73 cM, cytoband F
|
| Alliance: |
Ddx59em1(IMPC)J page
|
| IMPC: |
Ddx59 gene page |
|
Ddx59em1(IMPC)J/Ddx59em1(IMPC)J mice exhibit embryonic lethality, with embryos recovered at E7.5 but not at E9.5. Embryos are smaller, with a rudimentary egg cylinder, and failure of primitive streak formation and gastrulation.
Show the 1 phenotype image(s) involving this allele.
|
|
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele from project Ddx59-6150J-MP92R was generated at The Jackson Laboratory by injecting Cas9 RNA and guide sequence GCAGCAAGTGCTTGACGTTT, which resulted in an 8 bp deletion TTGACGTT in exon 5 beginning at Chromosome 1 positive strand position 136432352bp (GRCm38). This mutation is predicted to cause amino acid sequence changes after residue 368 and early truncation 5 amino acids later.
(J:188991)
|
| Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
4 reference(s) |
|