About   Help   FAQ
Adad1em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Adad1em1(IMPC)J
Name: adenosine deaminase domain containing 1; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5616653
Synonyms: Adad1em1J
Gene: Adad1  Location: Chr3:37117805-37165661 bp, + strand  Genetic Position: Chr3, 18.3 cM, cytoband B
Alliance: Adad1em1(IMPC)J page
IMPC: Adad1 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Adad1-6098-103P6MR was generated at The Jackson Laboratory by injecting Cas9 D10 (nickase) RNA and guide sequences CTTTCAGAGGAATATCCAGT and AAGTTGTAGTCTGTCGAATA, which resulted in a 29 bp deletion ATATTCCTCTGAAAGTTGTAGTCTGTCGA in exon 2 beginning at Chromosome 3 positive strand approximate position 37,064,302 bp (GRCm38). This mutation is predicted to cause amino acid sequence changes after residue 81 and an early truncation 9 amino acid later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Adad1 Mutation:  29 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  4 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/22/2025
MGI 6.24
The Jackson Laboratory