About   Help   FAQ
Prss56em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Prss56em1(IMPC)J
Name: serine protease 56; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5616626
Synonyms: Prss56em1J
Gene: Prss56  Location: Chr1:87111035-87116127 bp, + strand  Genetic Position: Chr1, 44.07 cM, cytoband C5
Alliance: Prss56em1(IMPC)J page
IMPC: Prss56 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Insertion
 
Mutation detailsThis allele from project Prss56-6052-104P4MB was generated at The Jackson Laboratory by injecting Cas9 RNA and guide sequence GCCCCAGGTCACCATGCCGC, which resulted in a 1 bp insertion (G) after exon1 beginning at Chromosome 1 positive strand position 87183497 bp (GRCm38), which is after the sequence GGTCACCATGC. This mutation is predicted to cause amino acid sequence changes after residue 2 and early truncation 66 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Prss56 Mutation:  23 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/30/2025
MGI 6.24
The Jackson Laboratory