Pcdh12^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Pcdh12^em1(IMPC)J
• Name: protocadherin 12; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5607865
• Synonyms: Pcdh12^em1J
• Gene: Pcdh12 Location: Chr18:38400145-38417454 bp, - strand Genetic Position: Chr18, 20.17 cM, cytoband B3
• Alliance: Pcdh12^em1(IMPC)J page
• IMPC: Pcdh12 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Pcdh12-6034J-P3MB was generated at The Jackson Laboratory by injecting Cas9 nickase RNA and guide sequences GTAGCATCATGCTTACCGGC and CATTCCTGCTAGGGCTCTTA, which resulted in a 38 bp deletion GCCATTCCTGCTAGGGCTCTTAGGGCCAGGAAGCTACT in exon1 beginning at Chromosome 18 negative strand position 38,284,057 bp (GRCm38). This mutation is predicted to cause amino acid sequence changes after residue 5 and early truncation 63 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Pcdh12 Mutation: 40 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 1 reference(s)