About   Help   FAQ
Fastkd5em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Fastkd5em1(IMPC)J
Name: FAST kinase domains 5; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5607864
Synonyms: Fastkd5em1J
Gene: Fastkd5  Location: Chr2:130455766-130471922 bp, - strand  Genetic Position: Chr2, 63.24 cM
Alliance: Fastkd5em1(IMPC)J page
IMPC: Fastkd5 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Fastkd5-6053J-P4MB was generated at The Jackson Laboratory by injecting Cas9 RNA and guide sequence GTGGTATGCCGAAGATTTAC, which resulted in a 14 bp deletion TGCCGAAGATTTAC in exon2 beginning at Chromosome 2 negative strand position 130,616,640 bp (GRCm38). This mutation is predicted to cause amino acid sequence changes after residue 5 and early truncation 21 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Fastkd5 Mutation:  50 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/24/2026
MGI 6.24
The Jackson Laboratory