Fastkd5^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Fastkd5^em1(IMPC)J
• Name: FAST kinase domains 5; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5607864
• Synonyms: Fastkd5^em1J
• Gene: Fastkd5 Location: Chr2:130455766-130471922 bp, - strand Genetic Position: Chr2, 63.24 cM
• Alliance: Fastkd5^em1(IMPC)J page
• IMPC: Fastkd5 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Fastkd5-6053J-P4MB was generated at The Jackson Laboratory by injecting Cas9 RNA and guide sequence GTGGTATGCCGAAGATTTAC, which resulted in a 14 bp deletion TGCCGAAGATTTAC in exon2 beginning at Chromosome 2 negative strand position 130,616,640 bp (GRCm38). This mutation is predicted to cause amino acid sequence changes after residue 5 and early truncation 21 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Fastkd5 Mutation: 50 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)