About   Help   FAQ
Ncoa6em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Ncoa6em1(IMPC)J
Name: nuclear receptor coactivator 6; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5607863
Synonyms: Ncoa6em1J
Gene: Ncoa6  Location: Chr2:155232585-155315741 bp, - strand  Genetic Position: Chr2, 77.26 cM, cytoband H2
Alliance: Ncoa6em1(IMPC)J page
IMPC: Ncoa6 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Ncoa6-6076J-P6MB was generated at The Jackson Laboratory by injecting Cas9 RNA and guide sequence ATCTACAATGGGCGACTCAG, which resulted in an 11 bp deletion GGCGACTCAGA in exon2 beginning at Chromosome 2 negative strand position 155,437,978 bp (GRCm38). This mutation is predicted to cause amino acid sequence changes after residue 22 and early truncation 2 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 2 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Ncoa6 Mutation:  101 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory