About   Help   FAQ
Zfp219em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Zfp219em1(IMPC)J
Name: zinc finger protein 219; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5607861
Synonyms: Zfp219em1J
Gene: Zfp219  Location: Chr14:52243534-52258190 bp, - strand  Genetic Position: Chr14, 26.76 cM
Alliance: Zfp219em1(IMPC)J page
IMPC: Zfp219 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Zfp219-6028J-P3MR was generated at The Jackson Laboratory by injecting Cas9 RNA and guide sequence GATCTGCAGCGCTACTCCAA, which resulted in a 19 bp deletion CGCTACTCCAACGGACCAG in exon 2 beginning at Chromosome 14 negative strand position 52,009,555 bp (GRCm38), which is predicted to cause amino acid sequence changes after residue 25 and early truncation 46 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 2 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Zfp219 Mutation:  129 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/22/2025
MGI 6.24
The Jackson Laboratory