About   Help   FAQ
Ttll10em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Ttll10em1(IMPC)J
Name: tubulin tyrosine ligase-like family, member 10; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5607785
Synonyms: Ttll10em1J
Gene: Ttll10  Location: Chr4:156119292-156135274 bp, - strand  Genetic Position: Chr4, 87.82 cM, cytoband E2
Alliance: Ttll10em1(IMPC)J page
IMPC: Ttll10 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Ttll10-5999J-P5ML was generated at The Jackson Laboratory by injecting Cas9 RNA and guide sequence AAAGATGGCCCTACACCCAC, which resulted in an 8 bp deletion CACAGGCC in exon3 beginning at Chromosome 4 negative strand position 156,048,583 bp (GRCm38), which is predicted to cause amino acid sequence changes after residue 4 and early truncation 72 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Ttll10 Mutation:  39 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  4 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
04/23/2024
MGI 6.23
The Jackson Laboratory