About   Help   FAQ
Dolkem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Dolkem1(IMPC)J
Name: dolichol kinase; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5605979
Synonyms: Dolk-, Dolkem1J
Gene: Dolk  Location: Chr2:30174243-30176346 bp, - strand  Genetic Position: Chr2, 21.49 cM
Alliance: Dolkem1(IMPC)J page
IMPC: Dolk gene page
Dolkem1(IMPC)J/Dolkem1(IMPC)J mice exhibit embryonic lethality, with embryos recovered at E7.5 but not at E9.5. Embryos are smaller, with a rudimentary egg cylinder, and failure of primitive streak formation and gastrulation.

Show the 1 phenotype image(s) involving this allele.

Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Dolk-5942-1899 was generated at The Jackson Laboratory by injecting Cas9 D10 (nickase) RNA and guide sequences CGTAGAAGGCCTGCACCGCG and ACGTCCAGTACAAGTGGGAC, which resulted in a 25 bp deletion in exon 1 beginning at Chromosome 2 negative strand position 30285881 (GRCm38). This mutation is predicted to cause amino acid sequence changes after residue 50 and early truncation 32 amino acids later. (J:188991)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 3 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Dolk Mutation:  14 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  5 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/06/2026
MGI 6.24
The Jackson Laboratory