Stk36^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Stk36^em1(IMPC)J
• Name: serine/threonine kinase 36; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5605978
• Synonyms: Stk36^em1J
• Gene: Stk36 Location: Chr1:74640604-74676053 bp, + strand Genetic Position: Chr1, 38.54 cM, cytoband C3
• Alliance: Stk36^em1(IMPC)J page
• IMPC: Stk36 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Stk36-5876J-2652 was generated at The Jackson Laboratory by injecting Cas9 D10 nickase RNA and guide sequences CGAGAGATTGAAATCATGCG and TTTCTCTGAGCGCCCCAGTT, which resulted in an 8 bp deletion (AAATCATG) in exon 3 beginning at Chromosome 1 positive strand position 74603211bp (GRCm38). This mutation is predicted to cause amino acid sequence changes after residue 52 and early truncation 15 amino acids later. (J:188991)

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Stk36 Mutation: 50 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)