About   Help   FAQ
Stk36em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Stk36em1(IMPC)J
Name: serine/threonine kinase 36; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5605978
Synonyms: Stk36em1J
Gene: Stk36  Location: Chr1:74640604-74676053 bp, + strand  Genetic Position: Chr1, 38.54 cM, cytoband C3
Alliance: Stk36em1(IMPC)J page
IMPC: Stk36 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Stk36-5876J-2652 was generated at The Jackson Laboratory by injecting Cas9 D10 nickase RNA and guide sequences CGAGAGATTGAAATCATGCG and TTTCTCTGAGCGCCCCAGTT, which resulted in an 8 bp deletion (AAATCATG) in exon 3 beginning at Chromosome 1 positive strand position 74603211bp (GRCm38). This mutation is predicted to cause amino acid sequence changes after residue 52 and early truncation 15 amino acids later. (J:188991)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Stk36 Mutation:  52 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  4 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/30/2025
MGI 6.24
The Jackson Laboratory