Rr251^tm2.1Ebres
Targeted Allele Detail

Summary

• Symbol: Rr251^tm2.1Ebres
• Name: regulatory region 251; targeted mutation 2.1, Emery H Bresnick
• MGI ID: MGI:5605695
• Synonyms: -3.9^-, Gata2^tm2.1Ebres
• Gene: Rr251 Location: unknown Genetic Position: Chr6, Syntenic
• Alliance: Rr251^tm2.1Ebres page

Mutation origin

• Germline Transmission: Earliest citation of germline transmission: J:207377
• Parent Cell Line: Not Specified (ES Cell)
• Strain of Origin: Not Specified

Mutation description

• Allele Type: Targeted (Modified regulatory region, No functional change)
• Mutations: Insertion, Intragenic deletion
• Mutation details: The 27 nucleotide -3.9 site (AGATAGGAAAATGGCCGCGCGCTATCT) containing inverted WGATAR motifs was replaced with a loxP site flanked neomycin resistance gene cassette. The neo cassette was removed through subsequent cre-mediated recombination. Expression levels of Gata2 mRNA in Lin- progenitors, Ter119+ erythroid cells and the fetal liver and brain are indistinguishable from that in wild-type mice. (J:207377)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Rr251 Mutation: 0 strains or lines available

References

• Original: J:207377 Sanalkumar R, et al., Mechanism governing a stem cell-generating cis-regulatory element. Proc Natl Acad Sci U S A. 2014 Mar 25;111(12):E1091-100
• All: 1 reference(s)