About   Help   FAQ
Rr251tm2.1Ebres
Targeted Allele Detail
Summary
Symbol: Rr251tm2.1Ebres
Name: regulatory region 251; targeted mutation 2.1, Emery H Bresnick
MGI ID: MGI:5605695
Synonyms: -3.9-, Gata2tm2.1Ebres
Gene: Rr251  Location: Chr6:88166782-88166810 bp  Genetic Position: Chr6, Syntenic
Alliance: Rr251tm2.1Ebres page
Mutation
origin
Germline Transmission:  Earliest citation of germline transmission: J:207377
Parent Cell Line:  Not Specified (ES Cell)
Strain of Origin:  Not Specified
Mutation
description
Allele Type:    Targeted (Modified regulatory region, No functional change)
Mutations:    Insertion, Intragenic deletion
 
Mutation detailsThe 27 nucleotide -3.9 site (AGATAGGAAAATGGCCGCGCGCTATCT) containing inverted WGATAR motifs was replaced with a loxP site flanked neomycin resistance gene cassette. The neo cassette was removed through subsequent cre-mediated recombination. Expression levels of Gata2 mRNA in Lin- progenitors, Ter119+ erythroid cells and the fetal liver and brain are indistinguishable from that in wild-type mice. (J:207377)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Rr251 Mutation:  0 strains or lines available
References
Original:  J:207377 Sanalkumar R, et al., Mechanism governing a stem cell-generating cis-regulatory element. Proc Natl Acad Sci U S A. 2014 Mar 25;111(12):E1091-100
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory