Rr251tm2.1Ebres
Targeted Allele Detail
|
|
| Symbol: |
Rr251tm2.1Ebres |
| Name: |
regulatory region 251; targeted mutation 2.1, Emery H Bresnick |
| MGI ID: |
MGI:5605695 |
| Synonyms: |
-3.9-, Gata2tm2.1Ebres |
| Gene: |
Rr251 Location: Chr6:88166782-88166810 bp Genetic Position: Chr6, Syntenic
|
| Alliance: |
Rr251tm2.1Ebres page
|
|
| Germline Transmission: |
Earliest citation of germline transmission:
J:207377
|
| Parent Cell Line: |
Not Specified (ES Cell)
|
| Strain of Origin: |
Not Specified
|
|
| Allele Type: |
|
Targeted (Modified regulatory region, No functional change) |
| Mutations: |
|
Insertion, Intragenic deletion
|
| |
|
Mutation details: The 27 nucleotide -3.9 site (AGATAGGAAAATGGCCGCGCGCTATCT) containing inverted WGATAR motifs was replaced with a loxP site flanked neomycin resistance gene cassette. The neo cassette was removed through subsequent cre-mediated recombination. Expression levels of Gata2 mRNA in Lin- progenitors, Ter119+ erythroid cells and the fetal liver and brain are indistinguishable from that in wild-type mice.
(J:207377)
|
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
| Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
| Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
| Carrying any Rr251 Mutation: |
0 strains or lines available
|
|
| Original: |
J:207377 Sanalkumar R, et al., Mechanism governing a stem cell-generating cis-regulatory element. Proc Natl Acad Sci U S A. 2014 Mar 25;111(12):E1091-100 |
| All: |
1 reference(s) |
|