About   Help   FAQ
Adad2em3(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Adad2em3(IMPC)J
Name: adenosine deaminase domain containing 2; endonuclease-mediated mutation 3, Jackson
MGI ID: MGI:5604765
Synonyms: Adad2em3
Gene: Adad2  Location: Chr8:120339486-120343663 bp, + strand  Genetic Position: Chr8, 68.05 cM, cytoband E1
Alliance: Adad2em3(IMPC)J page
IMPC: Adad2 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Not Specified)
Mutations:    Insertion, Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by injecting Cas9 RNA and guide sequence CCCATGCTCAGCGGTCCTAG which resulted in this single base pair (G) deletion at Chr 8 position 119,612,906 bp (J:188991, J:294176)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Mice Carrying this Mutation: 9 assay results
2 RNA-Seq or microarray experiment(s)
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Adad2 Mutation:  22 strains or lines available
References
Original:  J:294176 Snyder E, et al., ADAD1 and ADAD2, testis-specific adenosine deaminase domain-containing proteins, are required for male fertility. Sci Rep. 2020 Jul 14;10(1):11536
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/30/2025
MGI 6.24
The Jackson Laboratory