About   Help   FAQ
Myh10em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Myh10em1(IMPC)J
Name: myosin, heavy polypeptide 10, non-muscle; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5604248
Synonyms: Myh10em1J
Gene: Myh10  Location: Chr11:68582385-68707458 bp, + strand  Genetic Position: Chr11, 41.95 cM, cytoband B3
Alliance: Myh10em1(IMPC)J page
IMPC: Myh10 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Myh10-6078J-P4M2R was generated at The Jackson Laboratory by injecting Cas9 RNA and guide sequence GTCCACAAAGAGATACCTCT, which resulted in a 4 bp deletion GGTA in exon 2 beginning at Chromosome 11 positive strand position 68699275bp (GRCm38) and is predicted to cause amino acid sequence changes after residue 11 and an early truncation 66 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 2 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Myh10 Mutation:  95 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  4 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/30/2025
MGI 6.24
The Jackson Laboratory