Plk5^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Plk5^em1(IMPC)J
• Name: polo like kinase 5; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5585597
• Synonyms: Plk5^em1J
• Gene: Plk5 Location: Chr10:80192293-80201323 bp, + strand Genetic Position: Chr10, 39.72 cM
• Alliance: Plk5^em1(IMPC)J page
• IMPC: Plk5 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Intragenic deletion, Single point mutation
• Mutation details: This allele was generated at The Jackson Laboratory using Cas9 and a guide with spacer sequence TCGGGGCGCGTGTACCGGCG that targeted exon(s) ENSMUSE00000438549.4. This resulted in deletion(s) of 1 bp (location: Chr10:80192480-80192480; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Plk5 Mutation: 28 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)