About   Help   FAQ
Plk5em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Plk5em1(IMPC)J
Name: polo like kinase 5; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5585597
Synonyms: Plk5em1J
Gene: Plk5  Location: Chr10:80192293-80201323 bp, + strand  Genetic Position: Chr10, 39.72 cM
Alliance: Plk5em1(IMPC)J page
IMPC: Plk5 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutations:    Intragenic deletion, Single point mutation
 
Mutation detailsThis allele from project Plk5-5922J-4194 was generated at The Jackson Laboratory by injecting Cas9 RNA and guide sequence CGAGCCTGGGTCGCGCAGGA, which resulted in a 1 bp deletion G in exon 1 beginning at Chromosome 10 positive strand position 80356646 bp (GRCm38). This mutation is predicted to cause amino acid sequence changes after residue 28 and an early truncation 3 amino acids later. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Plk5 Mutation:  28 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory