About   Help   FAQ
Bmp2kem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Bmp2kem1(IMPC)J
Name: BMP2 inducible kinase; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5584154
Synonyms: Bmp2kem1J
Gene: Bmp2k  Location: Chr5:97145548-97239726 bp, + strand  Genetic Position: Chr5, 47.29 cM, cytoband E3
Alliance: Bmp2kem1(IMPC)J page
IMPC: Bmp2k gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Bmp2k-5786J-8977 was generated at The Jackson Laboratory by injecting Cas9 nickase RNA and left guide sequence GGCGAACACCCGGACCCCCA and right guide sequence CGGCCGCTACCAGGTCACCC, which resulted in an 163 bp deletion in exon1 beginning at CGCGGGCGGCGGGCTCGGCGGCG at Chromosome 5 positive strand position 96,997,992 bp (GRCm38/mm10) and extending through CGGGGTGTGGCGGCGGCTGCGGGGCC at 96,998,155 bp and is predicted to cause a frameshift mutation with early truncation. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 2 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Bmp2k Mutation:  38 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/30/2025
MGI 6.24
The Jackson Laboratory