About   Help   FAQ
Eogtem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Eogtem1(IMPC)J
Name: EGF domain specific O-linked N-acetylglucosamine transferase; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5578313
Synonyms: Eogtem1J
Gene: Eogt  Location: Chr6:97086985-97126143 bp, - strand  Genetic Position: Chr6, 44.88 cM
Alliance: Eogtem1(IMPC)J page
IMPC: Eogt gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Eogt-5785J-8958 was generated at The Jackson Laboratory by injecting Cas9 RNA and guide sequence TCTGAGGCTGACGATGCGCC, which resulted in a 25 bp deletion AGGCTGACGATGCGCCTGGCAAGGC in exon 4 beginning at Chromosome 6 negative strand position 97145373 bp (GRCm38) and is predicted to cause a frameshift mutation with early truncation. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Eogt Mutation:  44 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/30/2025
MGI 6.24
The Jackson Laboratory