Gt(ROSA)26Sor^{tm7(CAG-tdTomato*)Nat}
Targeted Allele Detail

Summary

• Symbol: Gt(ROSA)26Sor^{tm7(CAG-tdTomato*)Nat}
• Name: gene trap ROSA 26, Philippe Soriano; targeted mutation 7, Jeremy Nathans
• MGI ID: MGI:5578182
• Synonyms: R26 mLSL-ntdT
• Gene: Gt(ROSA)26Sor Location: Chr6:113044389-113054205 bp, - strand Genetic Position: Chr6, 52.73 cM
• Alliance: Gt(ROSA)26Sor^{tm7(CAG-tdTomato*)Nat} page

Mutation origin

• Germline Transmission: Earliest citation of germline transmission: J:101977
• Parent Cell Line: Not Specified (ES Cell)
• Strain of Origin: 129

Mutation description

• Allele Type: Targeted (Conditional ready, Reporter)
• Mutation: Insertion
• Mutation details: The targeting vector contains (from 5' to 3') a CAG promoter, a mutant loxP63(ATAACTTCGTATAGCCTACATTATACGAAGTTAT)-triple poly A/stop-wild type loxP (ATAACTTCGTATAGCATACATTATACGAAGTTAT), a nuclear-localized tdTomato with a C-terminal triple hemaglutinin (HA) epitope, an bovine growth hormone 3' UTR, and a Frt-PGKneo-Frt cassette. The stop cassette consists of three tandem SV40 polyadenylation/transcription termination sequences. (J:101977)

Expression

In Mice Carrying this Mutation:

1 RNA-Seq or microarray experiment(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Gt(ROSA)26Sor Mutation: 942 strains or lines available

References

• Original: J:101977 The Jackson Laboratory, Information obtained from The Jackson Laboratory, Bar Harbor, ME. Unpublished. 2005-2017
• All: 4 reference(s)