About   Help   FAQ
Krt77em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Krt77em1(IMPC)J
Name: keratin 77; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5576237
Synonyms: Krt77em1J
Gene: Krt77  Location: Chr15:101767166-101778140 bp, - strand  Genetic Position: Chr15, 57.08 cM
Alliance: Krt77em1(IMPC)J page
IMPC: Krt77 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele, from project Krt77-5764J-0643, was generated at The Jackson Laboratory by injecting Cas9 RNA and guide sequence CACTGGCACTTCGTCCCACT, which resulted in an 10 bp deletion GTGGGACGAA in exon1 beginning at Chromosome 15 negative strand position 101,869,384 bp (GRCm38) and is predicted to cause amino acid changes after residue 70 and a frameshift mutation with early truncation 68 residues later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Krt77 Mutation:  32 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/30/2025
MGI 6.24
The Jackson Laboratory