About   Help   FAQ
Mir181dtm1.1Oers
Targeted Allele Detail
Summary
Symbol: Mir181dtm1.1Oers
Name: microRNA 181d; targeted mutation 1.1, Nicolai S C van Oers
MGI ID: MGI:5576230
Synonyms: Mir181d tm1Oers
Gene: Mir181d  Location: Chr8:84905345-84905416 bp, - strand  Genetic Position: Chr8, 40.47 cM
Alliance: Mir181dtm1.1Oers page
Mutation
origin
Germline Transmission:  Earliest citation of germline transmission: J:94077
Parent Cell Line:  Other (see notes) (ES Cell)
Strain of Origin:  C57BL/6
Mutation
description
Allele Type:    Targeted (Null/knockout)
Mutations:    Insertion, Intragenic deletion
 
Mutation detailsThe hairpin loopwas eliminated and several additional nucleotides were introduced to create a new Pst I restriction site. The original sequence was acaattaacattcattgttgtcggtgggttg and the new sequence was acaattaagtgctaatgttgtccctgcagtgtg. A floxed neo selection cassette was subsequently removed by cre excision. Northern blot analhysis confirmed the lack of mature transcript without effecting expression of Mir181c. (J:94077, J:212571)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Mir181d Mutation:  1 strain or line available
Notes
ES cell line = LR2.6.1
References
Original:  J:94077 Mutant Mouse Regional Resource Centers, Information obtained from the Mutant Mouse Regional Resource Centers (MMRRC). Unpublished. 2004-2015;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/29/2025
MGI 6.24
The Jackson Laboratory