About   Help   FAQ
Mpdzem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Mpdzem1(IMPC)J
Name: multiple PDZ domain crumbs cell polarity complex component; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5571597
Synonyms: Mpdzem1J
Gene: Mpdz  Location: Chr4:81196742-81361052 bp, - strand  Genetic Position: Chr4, 38.0 cM
Alliance: Mpdzem1(IMPC)J page
IMPC: Mpdz gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutations:    Insertion, Intragenic deletion
 
Mutation detailsThis allele from project Mpdz-5657J-A was generated at The Jackson Laboratory by injecting Cas9 nickase RNA and guide sequences GCAGGATGCTAATGGCCTGC and TGCCAGAGGATCTTTGCCGC, which resulted in a 136 bp deletion of TGTGATTGCCAGAGGATCTTTGCCGCCGGTCTCCAGCCCACGGATTTCCCGCTCTCCATCAGCAGCCAGCACCATTTCAGCCCACTCGAATCCAGTGAGTAGCAGAGGCCCAGGATCGGAAGGTGCCACCTCTGGT and a 29 bp insertion of AATAACCCTAAAAGGTTAAAATATTAAAC in exon 6 beginning at Chromosome 4 negative strand position 81383820 bp (GRCm38) and is predicted to cause a frameshift mutation with early truncation. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 4 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Mpdz Mutation:  81 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  4 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory