About   Help   FAQ
Exoc4em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Exoc4em1(IMPC)J
Name: exocyst complex component 4; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5571596
Synonyms: Exoc4em1J
Gene: Exoc4  Location: Chr6:33226025-33950914 bp, + strand  Genetic Position: Chr6, 14.59 cM
Alliance: Exoc4em1(IMPC)J page
IMPC: Exoc4 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Exoc4-5677J-3730 was generated at The Jackson Laboratory by injecting Cas9 RNA and guide sequence ACCGAGATGAGCAGCCCCGA, which resulted in a 10 bp deletion GGGGCTGCTC beginning at Chromosome 6 positive strand 33249215 bp (GRCm38) and is predicted to cause a frameshift mutation with early truncation. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Exoc4 Mutation:  101 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  4 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/09/2025
MGI 6.24
The Jackson Laboratory