About   Help   FAQ
Adad2em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Adad2em1(IMPC)J
Name: adenosine deaminase domain containing 2; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5565206
Synonyms: Adad2em1J
Gene: Adad2  Location: Chr8:120339486-120343663 bp, + strand  Genetic Position: Chr8, 68.05 cM, cytoband E1
Alliance: Adad2em1(IMPC)J page
IMPC: Adad2 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutations:    Insertion, Intragenic deletion
 
Mutation detailsThis allele from project Adad2-5594J-B was generated at The Jackson Laboratory by injecting Cas9 RNA and guide sequence CCCATGCTCAGCGGTCCTAG, which resulted in an 8 bp deletion CTAGGACC and a 4 bp insertion ATGA in exon1 beginning at Chromosome 8 positive strand position 119612902 bp (GRCm38) and is predicted to cause a frameshift mutation with early truncation. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 2 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Adad2 Mutation:  22 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  4 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/30/2025
MGI 6.24
The Jackson Laboratory