About   Help   FAQ
Gt(ROSA)26Sortm1(tetO-RNAi:Hivep3)Glm
Targeted Allele Detail
Summary
Symbol: Gt(ROSA)26Sortm1(tetO-RNAi:Hivep3)Glm
Name: gene trap ROSA 26, Philippe Soriano; targeted mutation 1, Laurie H Glimcher
MGI ID: MGI:5550462
Synonyms: Shn3KD
Gene: Gt(ROSA)26Sor  Location: Chr6:113044389-113054205 bp, - strand  Genetic Position: Chr6, 52.73 cM
Alliance: Gt(ROSA)26Sortm1(tetO-RNAi:Hivep3)Glm page
Mutation
origin
Germline Transmission:  Earliest citation of germline transmission: J:201597
Parent Cell Line:  Not Specified (ES Cell)
Strain of Origin:  Not Specified
Mutation
description
Allele Type:    Targeted (Inducible, Knockdown)
Inducer:    doxycycline/tetracycline
Mutation:    Insertion
  Gt(ROSA)26Sortm1(tetO-RNAi:Hivep3)Glm involves 1 genes/genome features (Hivep3) View all
 
Mutation detailsThe targeting construct introduced into the locus a tetracycline response element driving inducible expression of a short-hairpin RNA (CCGGCCTGCTCTCAAGTAGTTTGTACTCGAGTACAAAC- TACTTGAGAGCAGGTTTTTG) targeting Hivep3. (J:201597)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Gt(ROSA)26Sor Mutation:  1089 strains or lines available
References
Original:  J:201597 Shim JH, et al., Schnurri-3 regulates ERK downstream of WNT signaling in osteoblasts. J Clin Invest. 2013 Sep 3;123(9):4010-22
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory