Gt(ROSA)26Sor^{tm1(tetO-RNAi:Hivep3)Glm}
Targeted Allele Detail

Summary

• Symbol: Gt(ROSA)26Sor^{tm1(tetO-RNAi:Hivep3)Glm}
• Name: gene trap ROSA 26, Philippe Soriano; targeted mutation 1, Laurie H Glimcher
• MGI ID: MGI:5550462
• Synonyms: Shn3^KD
• Gene: Gt(ROSA)26Sor Location: Chr6:113044389-113054205 bp, - strand Genetic Position: Chr6, 52.73 cM
• Alliance: Gt(ROSA)26Sor^{tm1(tetO-RNAi:Hivep3)Glm} page

Mutation origin

• Germline Transmission: Earliest citation of germline transmission: J:201597
• Parent Cell Line: Not Specified (ES Cell)
• Strain of Origin: Not Specified

Mutation description

• Allele Type: Targeted (Inducible, Knockdown)
• Inducer: doxycycline/tetracycline
• Mutation: Insertion
• Gt(ROSA)26Sor^{tm1(tetO-RNAi:Hivep3)Glm} involves 1 genes/genome features (Hivep3) View all
• Mutation details: The targeting construct introduced into the locus a tetracycline response element driving inducible expression of a short-hairpin RNA (CCGGCCTGCTCTCAAGTAGTTTGTACTCGAGTACAAAC- TACTTGAGAGCAGGTTTTTG) targeting Hivep3. (J:201597)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Gt(ROSA)26Sor Mutation: 942 strains or lines available

References

• Original: J:201597 Shim JH, et al., Schnurri-3 regulates ERK downstream of WNT signaling in osteoblasts. J Clin Invest. 2013 Sep 3;123(9):4010-22
• All: 1 reference(s)