Gt(ROSA)26Sortm2Jake
Targeted Allele Detail
|
|
| Symbol: |
Gt(ROSA)26Sortm2Jake |
| Name: |
gene trap ROSA 26, Philippe Soriano; targeted mutation 2, John A Kessler |
| MGI ID: |
MGI:5474352 |
| Synonyms: |
ROSA-MSP |
| Gene: |
Gt(ROSA)26Sor Location: Chr6:113044389-113054205 bp, - strand Genetic Position: Chr6, 52.73 cM
|
| Alliance: |
Gt(ROSA)26Sortm2Jake page
|
|
| Germline Transmission: |
Earliest citation of germline transmission:
J:192021
|
| Parent Cell Line: |
Not Specified (ES Cell)
|
| Strain of Origin: |
C57BL/6
|
|
| Allele Type: |
|
Targeted (Not Applicable) |
| Mutation: |
|
Insertion
|
| |
|
Mutation details: A cassette, consisting of the CAG (CMV-chicken beta actin) promoter, a splice acceptor site, a floxed pgk-neo stop construct, and the mouse Mir21 sponge sequence, was inserted via homologous recombination. The sponge sequence contained seven Mir21 binding sites (sequence UCAACAUCAGGACAUAAGCUA). This sequence acts as a competitive inhibitor for the microRNA.
(J:192021, J:194515)
|
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
| Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
| Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
| Carrying any Gt(ROSA)26Sor Mutation: |
1089 strains or lines available
|
|
| Original: |
J:192021 Bhalala OG, et al., microRNA-21 regulates astrocytic response following spinal cord injury. J Neurosci. 2012 Dec 12;32(50):17935-47 |
| All: |
2 reference(s) |
|