About   Help   FAQ
Gt(ROSA)26Sortm2Jake
Targeted Allele Detail
Summary
Symbol: Gt(ROSA)26Sortm2Jake
Name: gene trap ROSA 26, Philippe Soriano; targeted mutation 2, John A Kessler
MGI ID: MGI:5474352
Synonyms: ROSA-MSP
Gene: Gt(ROSA)26Sor  Location: Chr6:113044389-113054205 bp, - strand  Genetic Position: Chr6, 52.73 cM
Alliance: Gt(ROSA)26Sortm2Jake page
Mutation
origin
Germline Transmission:  Earliest citation of germline transmission: J:192021
Parent Cell Line:  Not Specified (ES Cell)
Strain of Origin:  C57BL/6
Mutation
description
Allele Type:    Targeted (Not Applicable)
Mutation:    Insertion
 
Mutation detailsA cassette, consisting of the CAG (CMV-chicken beta actin) promoter, a splice acceptor site, a floxed pgk-neo stop construct, and the mouse Mir21 sponge sequence, was inserted via homologous recombination. The sponge sequence contained seven Mir21 binding sites (sequence UCAACAUCAGGACAUAAGCUA). This sequence acts as a competitive inhibitor for the microRNA. (J:192021, J:194515)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Gt(ROSA)26Sor Mutation:  1095 strains or lines available
References
Original:  J:192021 Bhalala OG, et al., microRNA-21 regulates astrocytic response following spinal cord injury. J Neurosci. 2012 Dec 12;32(50):17935-47
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory