Npm1tm1Gsva
Targeted Allele Detail
|
Symbol: |
Npm1tm1Gsva |
Name: |
nucleophosmin 1; targeted mutation 1, George S Vassiliou |
MGI ID: |
MGI:5004857 |
Synonyms: |
Npm1flox-cA |
Gene: |
Npm1 Location: Chr11:33102287-33113206 bp, - strand Genetic Position: Chr11, 19.21 cM
|
Alliance: |
Npm1tm1Gsva page
|
|
Germline Transmission: |
Earliest citation of germline transmission:
J:172071
|
Parent Cell Line: |
Not Specified (ES Cell)
|
Strain of Origin: |
Not Specified
|
|
Allele Type: |
|
Targeted (Conditional ready, Humanized sequence) |
Mutations: |
|
Insertion, Intragenic deletion
|
|
|
Mutation details: A loxP site was inserted into intron 10 and a puromycin resistance gene cassette, a second loxP site and a modified exon 11 into intron 11. The exon modification involves replacing the end of the endogenous coding sequence and start of 3' UTR with the equivalent sequence for the human A variant of NPM1, which has a frameshift and slightly longer translated sequence: mouse sequence GCAGTGGAGGAAATCTCTTTAAGAAAAGG (reverse strand) was replaced with human sequence TCTGGCAGTGGAGGAAGTCTCTTTAAGAAAATA.
(J:175778)
|
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
Carrying any Npm1 Mutation: |
34 strains or lines available
|
|
Original: |
J:172071 Vassiliou GS, et al., Mutant nucleophosmin and cooperating pathways drive leukemia initiation and progression in mice. Nat Genet. 2011 May;43(5):470-5 |
All: |
15 reference(s) |
|