About   Help   FAQ
Npm1tm1Gsva
Targeted Allele Detail
Summary
Symbol: Npm1tm1Gsva
Name: nucleophosmin 1; targeted mutation 1, George S Vassiliou
MGI ID: MGI:5004857
Synonyms: Npm1flox-cA
Gene: Npm1  Location: Chr11:33102287-33113206 bp, - strand  Genetic Position: Chr11, 19.21 cM
Alliance: Npm1tm1Gsva page
Mutation
origin
Germline Transmission:  Earliest citation of germline transmission: J:172071
Parent Cell Line:  Not Specified (ES Cell)
Strain of Origin:  Not Specified
Mutation
description
Allele Type:    Targeted (Conditional ready, Humanized sequence)
Mutations:    Insertion, Intragenic deletion
 
Mutation detailsA loxP site was inserted into intron 10 and a puromycin resistance gene cassette, a second loxP site and a modified exon 11 into intron 11. The exon modification involves replacing the end of the endogenous coding sequence and start of 3' UTR with the equivalent sequence for the human A variant of NPM1, which has a frameshift and slightly longer translated sequence: mouse sequence GCAGTGGAGGAAATCTCTTTAAGAAAAGG (reverse strand) was replaced with human sequence TCTGGCAGTGGAGGAAGTCTCTTTAAGAAAATA. (J:175778)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 2 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Npm1 Mutation:  34 strains or lines available
References
Original:  J:172071 Vassiliou GS, et al., Mutant nucleophosmin and cooperating pathways drive leukemia initiation and progression in mice. Nat Genet. 2011 May;43(5):470-5
All:  16 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/30/2025
MGI 6.24
The Jackson Laboratory