About   Help   FAQ
Flt3tm1Dgg
Targeted Allele Detail
Summary
Symbol: Flt3tm1Dgg
Name: FMS-like tyrosine kinase 3; targeted mutation 1, D Gilliland
MGI ID: MGI:3763385
Synonyms: Flt3ITD, FLT3/ITD
Gene: Flt3  Location: Chr5:147267551-147337299 bp, - strand  Genetic Position: Chr5, 86.88 cM, cytoband G3
Alliance: Flt3tm1Dgg page
Mutation
origin
Germline Transmission:  Earliest citation of germline transmission: J:126003
Parent Cell Line:  R1 (ES Cell)
Strain of Origin:  (129X1/SvJ x 129S1/Sv)F1-Kitl+
Mutation
description
Allele Type:    Targeted (Humanized sequence)
Mutations:    Insertion, Intragenic deletion
 
Mutation detailsThe human W51 mutation which causes the duplication of amino acid 595 to 601 (REYEYDL; AGAGAATATGAATATGATCTC) was inserted in-frame into exon 14, replacing the endogenous single copy (RDYEYDL; AGGGACTATGAATATGACCTT). A loxP site flanked neomycin selection cassette was inserted into intron 15. (J:126003)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Disease models
Loading...
Expression
In Mice Carrying this Mutation: 3 RNA-Seq or microarray experiment(s)
In Structures Affected by this Mutation: 4 anatomical structure(s)
Tumor Data
List all tumor models in MMHCdb carrying Flt3tm1Dgg
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 8 strains available      Cell Lines: 0 lines available
Carrying any Flt3 Mutation:  94 strains or lines available
References
Original:  J:126003 Lee BH, et al., FLT3 mutations confer enhanced proliferation and survival properties to multipotent progenitors in a murine model of chronic myelomonocytic leukemia. Cancer Cell. 2007 Oct;12(4):367-80
All:  74 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory