Klrc1em2Lumc
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Klrc1em2Lumc |
| Name: |
killer cell lectin-like receptor subfamily C, member 1; endonuclease-mediated mutation 2, Leiden University Medical Centre |
| MGI ID: |
MGI:6473464 |
| Gene: |
Klrc1 Location: Chr6:129642978-129655936 bp, - strand Genetic Position: Chr6, 63.44 cM, cytoband G1-2
|
| Alliance: |
Klrc1em2Lumc page
|
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: Mouse zygotes were electroporated with two CRISPR/Cas9 RNP complexes, one using sgRNA ATCTCAGTAAAGAATCTCCA targeting intron 2, the other sgRNA CTACAGGTTGAAAACTGCTG targeting intron 4. Founder mice with a deletion of exon 3 and 4 were identified.
(J:341640, J:349488)
|
|
|
| Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
| Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
| Carrying any Klrc1 Mutation: |
11 strains or lines available
|
|
| Original: |
J:341640 Leiden University, Leiden University Direct Data Submission. MGI Direct Data Submission. 2023; |
| All: |
2 reference(s) |
|
Analysis Tools
